Product Details

SNP ID: rs150102707
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.19:14042486 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGAGCTGAAGACCATACCCCTGACC[C/T]CTGTTGAGATCCAAGATTTGGAGCT
Phenotype: MIM: 605350
Polymorphism: C/T, Transition Substitution
Allele Nomenclature
Literature Links: IL27RA PubMed Links
Additional Information: For this assay, SNP(s) [rs35026308] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004843.3	701	Missense Mutation	CCT,TCT	P190S	NP_004834.1