Product Details

SNP ID: rs150622911
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:38932604 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCCACACCCTGCAGGAGCACCAGAT[A/T]GTCCTTGTGGAGGGCGGCCGCACCC
Phenotype: MIM: 609094 MIM: 603021 MIM: 612804
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: FBXO17 PubMed Links

Gene Details

Gene: FBXO17
Gene Name: F-box protein 17

There are no transcripts associated with this gene.

Gene: MRPS12
Gene Name: mitochondrial ribosomal protein S12

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_021107.1	631	Silent Mutation	ATA,ATT	I107I	NP_066930.1
NM_033362.3	631	Silent Mutation	ATA,ATT	I107I	NP_203526.1
NM_033363.1	631	Silent Mutation	ATA,ATT	I107I	NP_203527.1

Gene: SARS2
Gene Name: seryl-tRNA synthetase 2, mitochondrial

There are no transcripts associated with this gene.

View Full Product Details