Product Details

SNP ID: rs113101028
Assay Type: Functionally tested
NCBI dbSNP Submissions: 3
Location: Chr.1:16977161 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGACGTGGTCAGGGAACGGCGGCAG[C/T]GGGTCCAGGTCATACTGGCCCTGAG
Phenotype: MIM: 610513 MIM: 615776 MIM: 156790
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ATP13A2 PubMed Links

Gene Details

Gene: ATP13A2
Gene Name: ATPase 13A2

There are no transcripts associated with this gene.

Gene: CROCC
Gene Name: ciliary rootlet coiled-coil, rootletin

There are no transcripts associated with this gene.

Gene: MFAP2
Gene Name: microfibrillar associated protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001135247.1	186	Silent Mutation	CCA,CCG	P24P	NP_001128719.1
NM_001135248.1	186	Silent Mutation	CCA,CCG	P24P	NP_001128720.1
NM_002403.3	186	Silent Mutation	CCA,CCG	P25P	NP_002394.1
NM_017459.2	186	Silent Mutation	CCA,CCG	P25P	NP_059453.1
XM_011541476.2	186	Silent Mutation	CCA,CCG	P25P	XP_011539778.1

View Full Product Details