Product Details

SNP ID: rs114262920
Assay Type: Functionally tested
NCBI dbSNP Submissions: 11
Location: Chr.1:151771603 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTTATCCATATATTTCAGTTGAGGT[A/G]CTATAGATGTGGAGAAAACCAGAGA
Phenotype: MIM: 611824 MIM: 605138 MIM: 609501
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MRPL9 PubMed Links

Gene Details

Gene: MRPL9
Gene Name: mitochondrial ribosomal protein L9

There are no transcripts associated with this gene.

Gene: OAZ3
Gene Name: ornithine decarboxylase antizyme 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001134939.1	2261	Intron			NP_001128411.1
NM_001301371.1	2261	Intron			NP_001288300.1
NM_016178.2	2261	Intron			NP_057262.2

Gene: TDRKH
Gene Name: tudor and KH domain containing

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001083963.1	2261	Intron			NP_001077432.1
NM_001083964.1	2261	Intron			NP_001077433.1
NM_001083965.1	2261	Intron			NP_001077434.1
NM_006862.3	2261	UTR 3			NP_006853.2
XM_005244856.4	2261	Intron			XP_005244913.1
XM_017000122.1	2261	Intron			XP_016855611.1
XM_017000123.1	2261	Intron			XP_016855612.1
XM_017000124.1	2261	Intron			XP_016855613.1
XM_017000125.1	2261	Intron			XP_016855614.1
XM_017000126.1	2261	UTR 3			XP_016855615.1
XM_017000127.1	2261	UTR 3			XP_016855616.1
XM_017000128.1	2261	Intron			XP_016855617.1
XM_017000129.1	2261	Intron			XP_016855618.1
XM_017000130.1	2261	UTR 3			XP_016855619.1

View Full Product Details