Product Details

SNP ID: rs115248593
Assay Type: Functionally tested
NCBI dbSNP Submissions: 12
Location: Chr.1:16977650 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATGTCTGCTTGTTTCCTATTTGTCT[C/T]CCTTCCCTGGACTGGCAGCATGATG
Phenotype: MIM: 610513 MIM: 615776 MIM: 156790
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ATP13A2 PubMed Links

Gene Details

Gene: ATP13A2
Gene Name: ATPase 13A2

There are no transcripts associated with this gene.

Gene: CROCC
Gene Name: ciliary rootlet coiled-coil, rootletin

There are no transcripts associated with this gene.

Gene: MFAP2
Gene Name: microfibrillar associated protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001135247.1		Intron			NP_001128719.1
NM_001135248.1		Intron			NP_001128720.1
NM_002403.3		Intron			NP_002394.1
NM_017459.2		Intron			NP_059453.1
XM_011541476.2		Intron			XP_011539778.1

View Full Product Details