Product Details

SNP ID: rs137853861
Assay Type: Functionally tested
NCBI dbSNP Submissions: 2
Location: Chr.1:23796234 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTTGGCGTAACAGGCTGCCACATCA[T/C]CTTCCCGCCGTGCCACCACCTTGTA
Phenotype: MIM: 606953 MIM: 613898 MIM: 616143
Polymorphism: T/C, Transition substitution
Allele Nomenclature
Literature Links: GALE PubMed Links

Gene Details

Gene: GALE
Gene Name: UDP-galactose-4-epimerase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000403.3	1074	Missense Mutation	GAT,GGT	D302G	NP_000394.2
NM_001008216.1	1074	Missense Mutation	GAT,GGT	D302G	NP_001008217.1
NM_001127621.1	1074	Missense Mutation	GAT,GGT	D302G	NP_001121093.1

Gene: HMGCL
Gene Name: 3-hydroxymethyl-3-methylglutaryl-CoA lyase

There are no transcripts associated with this gene.

Gene: LYPLA2
Gene Name: lysophospholipase II

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_007260.2	1074	Intron			NP_009191.1
XM_005245728.4	1074	Intron			XP_005245785.1
XM_017000165.1	1074	Intron			XP_016855654.1

Gene: PITHD1
Gene Name: PITH domain containing 1

There are no transcripts associated with this gene.

View Full Product Details