Product Details

SNP ID

rs138106551

Assay Type

Functionally Tested

NCBI dbSNP Submissions

14

Location

Chr.1:21598917 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CTGTATCTGTTGTATCTGGGGCAGC[A/G]CTTGGCAAGGAACAGGGGCCCACTG

Phenotype

MIM: 600278

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

RAP1GAP PubMed Links

Additional Information

For this assay, SNP(s) [rs150834820] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

RAP1GAP

Gene Name

RAP1 GTPase activating protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145657.1		Intron			NP_001139129.1
NM_001145658.1		Intron			NP_001139130.1
NM_002885.2		Intron			NP_002876.2
XM_005245955.3		Intron			XP_005246012.2
XM_006710804.2		Intron			XP_006710867.2
XM_006710805.2		Intron			XP_006710868.2
XM_017001965.1		Intron			XP_016857454.1
XM_017001966.1		Intron			XP_016857455.1
XM_017001967.1		Intron			XP_016857456.1
XM_017001968.1		Intron			XP_016857457.1
XM_017001969.1		Intron			XP_016857458.1
XM_017001970.1		Intron			XP_016857459.1
XM_017001971.1		Intron			XP_016857460.1
XM_017001972.1		Intron			XP_016857461.1
XM_017001973.1		Intron			XP_016857462.1
XM_017001974.1		Intron			XP_016857463.1
XM_017001975.1		Intron			XP_016857464.1
XM_017001976.1		Intron			XP_016857465.1
XM_017001977.1		Intron			XP_016857466.1
XM_017001978.1		Intron			XP_016857467.1
XM_017001979.1		Intron			XP_016857468.1
XM_017001980.1		Intron			XP_016857469.1
XM_017001981.1		Intron			XP_016857470.1
XM_017001982.1		Intron			XP_016857471.1
XM_017001983.1		Intron			XP_016857472.1
XM_017001984.1		Intron			XP_016857473.1
XM_017001985.1		Intron			XP_016857474.1
XM_017001986.1		Intron			XP_016857475.1
XM_017001987.1		Intron			XP_016857476.1
XM_017001988.1		Intron			XP_016857477.1
XM_017001989.1		Intron			XP_016857478.1
XM_017001990.1		Intron			XP_016857479.1
XM_017001991.1		Intron			XP_016857480.1

View Full Product Details