Product Details

SNP ID: rs139083235
Assay Type: Functionally tested
NCBI dbSNP Submissions: 3
Location: Chr.1:206474343 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCCCCAATGGCAGAAATCCGGAGAG[C/T]TGGTTGCTGTGAAGGTCTTCAACAC
Phenotype: MIM: 605048 MIM: 606524
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: IKBKE PubMed Links

Gene Details

Gene: IKBKE
Gene Name: inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001193321.1	678	UTR 5			NP_001180250.1
NM_001193322.1	678	Silent Mutation	CTG,TTG	L34L	NP_001180251.1
NM_014002.3	678	Silent Mutation	CTG,TTG	L34L	NP_054721.1
XM_005273356.2	678	Missense Mutation	CTG,TTG	L34L	XP_005273413.1
XM_017002868.1	678	UTR 5			XP_016858357.1

Gene: MIR6769B
Gene Name: microRNA 6769b

There are no transcripts associated with this gene.

Gene: SRGAP2
Gene Name: SLIT-ROBO Rho GTPase activating protein 2

There are no transcripts associated with this gene.

View Full Product Details