Product Details

SNP ID: rs139743519
Assay Type: Functionally tested
NCBI dbSNP Submissions: 1
Location: Chr.1:151286540 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CACCGCCAGACATTTCTGTAGTCAG[C/T]GTCATTGTCAAGAACACTGTGTGTC
Phenotype: MIM: 602758 MIM: 610568
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: LOC100507670 PubMed Links

Gene Details

Gene: LOC100507670
Gene Name: uncharacterized LOC100507670

There are no transcripts associated with this gene.

Gene: PI4KB
Gene Name: phosphatidylinositol 4-kinase beta

There are no transcripts associated with this gene.

Gene: ZNF687
Gene Name: zinc finger protein 687

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001304763.1	551	Silent Mutation	AGC,AGT	S83S	NP_001291692.1
NM_001304764.1	551	Silent Mutation	AGC,AGT	S83S	NP_001291693.1
NM_020832.2	551	Silent Mutation	AGC,AGT	S83S	NP_065883.1
XM_005245366.3	551	Silent Mutation	AGC,AGT	S92S	XP_005245423.1
XM_011509811.2	551	Silent Mutation	AGC,AGT	S83S	XP_011508113.1
XM_011509812.2	551	Silent Mutation	AGC,AGT	S83S	XP_011508114.1
XM_011509813.2	551	Silent Mutation	AGC,AGT	S83S	XP_011508115.1

View Full Product Details