Product Details

SNP ID: rs144211111
Assay Type: Functionally tested
NCBI dbSNP Submissions: 12
Location: Chr.1:155257587 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGAGGATAGAAAGCCCAAAGCCTGC[A/G]CCATTGTTGGTTTCCACACAGAAGC
Phenotype: MIM: 602989 MIM: 606913
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CLK2 PubMed Links

Gene Details

Gene: CLK2
Gene Name: CDC like kinase 2

There are no transcripts associated with this gene.

Gene: FAM189B
Gene Name: family with sequence similarity 189 member B

There are no transcripts associated with this gene.

Gene: SCAMP3
Gene Name: secretory carrier membrane protein 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005698.3	744	Silent Mutation			NP_005689.2
NM_052837.2	744	Silent Mutation			NP_443069.1
XM_006711105.3	744	Silent Mutation			XP_006711168.1
XM_006711106.3	744	Silent Mutation			XP_006711169.1
XM_016999991.1	744	Intron			XP_016855480.1

View Full Product Details