Product Details

SNP ID: rs144246192
Assay Type: Functionally tested
NCBI dbSNP Submissions: 2
Location: Chr.1:112723087 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTGCAACCGGAACCGCATCGAGGAG[C/T]GCTCCCAGACGGTGAAATGCTCCTG
Phenotype: MIM: 609957
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: FAM19A3 PubMed Links

Gene Details

Gene: FAM19A3
Gene Name: family with sequence similarity 19 member A3, C-C motif chemokine like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001004440.1	543	Missense Mutation	CGC,TGC	R63C	NP_001004440.1
NM_182759.2	543	Missense Mutation	CGC,TGC	R63C	NP_877436.1
XM_005270766.3	543	Missense Mutation	CGC,TGC	R63C	XP_005270823.1
XM_006710582.3	543	Missense Mutation	CGC,TGC	R63C	XP_006710645.1

Gene: LOC105378910
Gene Name: uncharacterized LOC105378910

There are no transcripts associated with this gene.

Gene: PPM1J
Gene Name: protein phosphatase, Mg2+/Mn2+ dependent 1J

There are no transcripts associated with this gene.

View Full Product Details