Product Details

SNP ID: rs145077492
Assay Type: Functionally tested
NCBI dbSNP Submissions: 3
Location: Chr.1:27966917 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGTGACAGCATTCTCCTGGTGGCCA[C/T]CTGGGTGACTCATAGCTCCTGGCTG
Phenotype: MIM: 601655
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: EYA3 PubMed Links

Gene Details

Gene: EYA3
Gene Name: EYA transcriptional coactivator and phosphatase 3

There are no transcripts associated with this gene.

Gene: SMPDL3B
Gene Name: sphingomyelin phosphodiesterase acid like 3B

There are no transcripts associated with this gene.

Gene: XKR8
Gene Name: XK related 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_018053.3	1513	Missense Mutation	ACC,ATC	T302I	NP_060523.2
XM_011541679.2	1513	Missense Mutation	ACC,ATC	T356I	XP_011539981.1
XM_011541680.2	1513	Missense Mutation	ACC,ATC	T320I	XP_011539982.1

View Full Product Details