Product Details
- SNP ID
-
rs145285600
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
10
- Location
-
Chr.1:34761508 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TGGGCCCTACAGCTCATCCTGGTCA[C/T]GTGCCCCTCACTGCTCGTGGTCATG
- Phenotype
-
MIM: 605425
MIM: 604493
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
GJB4
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs76188300] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- GJB4
- Gene Name
- gap junction protein beta 4
- Gene
- GJB5
- Gene Name
- gap junction protein beta 5
There are no transcripts associated with this gene.
View Full Product Details