Product Details

SNP ID: rs146444571
Assay Type: Functionally tested
NCBI dbSNP Submissions: 20
Location: Chr.1:156293114 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAGAACCAAGCCGCCCCCTAGCAGC[A/G]TGAGCCCTGGGGCACCCAGGGCCAC
Phenotype: MIM: 610962 MIM: 615531
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: GLMP PubMed Links

Gene Details

Gene: GLMP
Gene Name: glycosylated lysosomal membrane protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001256604.1	854	Missense Mutation	ACG,ATG	T335M	NP_001243533.1
NM_001256605.1	854	Missense Mutation	ACG,ATG	T298M	NP_001243534.1
NM_001256608.1	854	Silent Mutation	CAC,CAT	H298H	NP_001243537.1
NM_001256609.1	854	Missense Mutation	ACG,ATG	T303M	NP_001243538.1
NM_144580.2	854	Missense Mutation	ACG,ATG	T384M	NP_653181.1
XM_011509117.2	854	Missense Mutation	ACG,ATG	T207M	XP_011507419.1
XM_017000149.1	854	UTR 3			XP_016855638.1

Gene: SMG5
Gene Name: SMG5, nonsense mediated mRNA decay factor

There are no transcripts associated with this gene.

Gene: TMEM79
Gene Name: transmembrane protein 79

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032323.2	854	Intron			NP_115699.1

Gene: VHLL
Gene Name: von Hippel-Lindau tumor suppressor like

There are no transcripts associated with this gene.

View Full Product Details