Product Details

SNP ID: rs146590949
Assay Type: Functionally tested
NCBI dbSNP Submissions: 6
Location: Chr.1:150152202 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCATCTAAAAGAACATCTACTGAG[G/T]CATCTAGGGAAGAACTAAGCTGTGC
Phenotype: MIM: 608335 MIM: 610035
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: LOC105371433 PubMed Links

Gene Details

Gene: LOC105371433
Gene Name: uncharacterized LOC105371433

There are no transcripts associated with this gene.

Gene: PLEKHO1
Gene Name: pleckstrin homology domain containing O1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001304722.1		Intron			NP_001291651.1
NM_001304723.1		Intron			NP_001291652.1
NM_001304724.1		Intron			NP_001291653.1
NM_016274.5		Intron			NP_057358.2
XM_017001420.1		Intron			XP_016856909.1

Gene: VPS45
Gene Name: vacuolar protein sorting 45 homolog

There are no transcripts associated with this gene.

View Full Product Details