Product Details

SNP ID: rs148192841
Assay Type: Functionally Tested
NCBI dbSNP Submissions: 3
Location: Chr.1:236394487 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TAAACAGATGGGGAGAGGCACTAAA[A/G]CTCCTGGTCACCAAGAGGGTATGTA
Phenotype: MIM: 606603
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: EDARADD PubMed Links
Additional Information: For this assay, SNP(s) [rs966365] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_080738.3	108	Intron			NP_542776.1
NM_145861.2	108	Missense Mutation	ACT,GCT	T15A	NP_665860.2