Product Details

SNP ID: rs148895370
Assay Type: Functionally tested
NCBI dbSNP Submissions: 14
Location: Chr.1:155322113 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACTCAGCTCCTGCTCAGATCTTAGC[C/G]CCGATGAGTCCCCTGTCTCAGTCTA
Phenotype: MIM: 134629
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: FDPS PubMed Links

Gene Details

Gene: FDPS
Gene Name: farnesyl diphosphate synthase

There are no transcripts associated with this gene.

Gene: LOC105371451
Gene Name: uncharacterized LOC105371451

There are no transcripts associated with this gene.

Gene: RUSC1
Gene Name: RUN and SH3 domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001105203.1	569	Missense Mutation	CCC,GCC	P114A	NP_001098673.1
NM_001105204.1	569	Missense Mutation	CCC,GCC	P114A	NP_001098674.1
NM_001105205.1	569	Intron			NP_001098675.1
NM_001278227.1	569	Intron			NP_001265156.1
NM_001278228.1	569	Intron			NP_001265157.1
NM_001278229.1	569	Intron			NP_001265158.1
NM_001278230.1	569	Intron			NP_001265159.1
NM_014328.4	569	Intron			NP_055143.2
XM_006711254.1	569	Missense Mutation	CCC,GCC	P114A	XP_006711317.1
XM_006711256.1	569	Missense Mutation	CCC,GCC	P114A	XP_006711319.1
XM_006711257.1	569	Intron			XP_006711320.1
XM_017000891.1	569	Missense Mutation	CCC,GCC	P114A	XP_016856380.1
XM_017000892.1	569	Intron			XP_016856381.1

Gene: RUSC1-AS1
Gene Name: RUSC1 antisense RNA 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001039517.1	569	Intron			NP_001034606.1

View Full Product Details