Product Details
- SNP ID
-
rs149847629
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
10
- Location
-
Chr.1:228108142 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GACAGTGGACAATAGCAAGGACTAG[A/G]GAGGATTAGAATGGCGGTTTCCTGC
- Phenotype
-
MIM: 103180
MIM: 611859
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
ARF1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs550840228] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ARF1
- Gene Name
- ADP ribosylation factor 1
There are no transcripts associated with this gene.
- Gene
- C1orf35
- Gene Name
- chromosome 1 open reading frame 35
There are no transcripts associated with this gene.
- Gene
- MRPL55
- Gene Name
- mitochondrial ribosomal protein L55
View Full Product Details