Product Details
- SNP ID
-
rs150412578
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
6
- Location
-
Chr.1:167094855 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TCAGAGGTTGGCAGGTTGTCATGGC[A/G]ACCAGAAAGGACACAGAGGAGGAGC
- Phenotype
-
MIM: 602171
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
DUSP27
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs16858433] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- DUSP27
- Gene Name
- dual specificity phosphatase 27 (putative)
- Gene
- GPA33
- Gene Name
- glycoprotein A33
There are no transcripts associated with this gene.
- Gene
- LOC105371598
- Gene Name
- uncharacterized LOC105371598
There are no transcripts associated with this gene.
View Full Product Details