Product Details

SNP ID: rs143595580
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.20:45207086 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCAACATCATCTTTGTACTTTCCCT[C/G]CTCCTCATCTTGGAGAAGCAAGCAG
Phenotype: MIM: 182140
Polymorphism: C/G, Transversion Substitution
Allele Nomenclature
Literature Links: SEMG1 PubMed Links
Additional Information: For this assay, SNP(s) [rs2233882,rs2233883] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003007.4	123	Silent Mutation	CTC,CTG	L11L	NP_002998.1