Product Details

SNP ID: rs144190881
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:33667837 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTTCAGCGTGGGTAACGGGTGCTGC[A/G]TCTGCCTCAGCAGTGAGCGCTTCCG
Phenotype: MIM: 189971 MIM: 612478
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ACTL10 PubMed Links

Gene Details

Gene: ACTL10
Gene Name: actin like 10

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001024675.1	1340	Missense Mutation	ATC,GTC	I114V	NP_001019846.1

Gene: C20orf144
Gene Name: chromosome 20 open reading frame 144

There are no transcripts associated with this gene.

Gene: E2F1
Gene Name: E2F transcription factor 1

There are no transcripts associated with this gene.

Gene: NECAB3
Gene Name: N-terminal EF-hand calcium binding protein 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_031231.3	1340	Intron			NP_112508.3
NM_031232.3	1340	Intron			NP_112509.3
XM_005260510.1	1340	Intron			XP_005260567.1
XM_011528991.1	1340	Intron			XP_011527293.1
XM_011528992.2	1340	Intron			XP_011527294.1
XM_017028015.1	1340	Intron			XP_016883504.1
XM_017028016.1	1340	Intron			XP_016883505.1

View Full Product Details