Product Details

SNP ID: rs138113935
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.21:46235369 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGCCTTTCCAGGTGCTTTAGTCGTT[C/T]GCCTAGACACGTTCCTGTCGCCTCT
Phenotype: MIM: 600909 MIM: 603294
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: LSS PubMed Links

Gene Details

Gene: LSS
Gene Name: lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)

There are no transcripts associated with this gene.

Gene: MCM3AP
Gene Name: minichromosome maintenance complex component 3 associated protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003906.4	6422	Missense Mutation	AAA,GAA	K1948E	NP_003897.2
XM_005261203.4	6422	Missense Mutation	AAA,GAA	K1948E	XP_005261260.1
XM_005261204.4	6422	Missense Mutation	AAA,GAA	K1948E	XP_005261261.1
XM_005261205.3	6422	Missense Mutation	AAA,GAA	K1948E	XP_005261262.1

Gene: MCM3AP-AS1
Gene Name: MCM3AP antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details