Product Details

SNP ID: rs138450273
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.21:33549917 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTAATCTCAGAGCAGTCAGAGCAGT[A/C]TGTGGCAGTAATGCCAGAACCATCC
Phenotype: MIM: 138440 MIM: 182465
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: GART PubMed Links

Gene Details

Gene: GART
Gene Name: phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase

There are no transcripts associated with this gene.

Gene: MIR6501
Gene Name: microRNA 6501

There are no transcripts associated with this gene.

Gene: SON
Gene Name: SON DNA binding protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001291411.1	741	Missense Mutation	TAT,TCT	Y229S	NP_001278340.1
NM_001291412.1	741	Intron			NP_001278341.1
NM_032195.2	741	Missense Mutation	TAT,TCT	Y229S	NP_115571.2
NM_138927.2	741	Missense Mutation	TAT,TCT	Y229S	NP_620305.2

View Full Product Details