Product Details

SNP ID: rs121913042
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.22:50526650 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCAGAGCAGCGCCTCCTCCACCTCC[G/A]GGGCGTGGCCCACGCAGCGACCCAG
Phenotype: MIM: 611230 MIM: 604272 MIM: 131222
Polymorphism: G/A, Transition substitution
Allele Nomenclature
Literature Links: NCAPH2 PubMed Links

Gene Details

Gene: NCAPH2
Gene Name: non-SMC condensin II complex subunit H2

There are no transcripts associated with this gene.

Gene: ODF3B
Gene Name: outer dense fiber of sperm tails 3B

There are no transcripts associated with this gene.

Gene: SCO2
Gene Name: SCO2 cytochrome c oxidase assembly protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001169109.1	1081	Intron			NP_001162580.1
NM_001169110.1	1081	Intron			NP_001162581.1
NM_001169111.1	1081	Intron			NP_001162582.1
NM_005138.2	1081	Intron			NP_005129.2

Gene: TYMP
Gene Name: thymidine phosphorylase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001113755.2	1081	Missense Mutation	CCG,CTG	P285L	NP_001107227.1
NM_001113756.2	1081	Missense Mutation	CCG,CTG	P285L	NP_001107228.1
NM_001257988.1	1081	Missense Mutation	CCG,CTG	P285L	NP_001244917.1
NM_001257989.1	1081	Missense Mutation	CCG,CTG	P285L	NP_001244918.1
NM_001953.4	1081	Missense Mutation	CCG,CTG	P285L	NP_001944.1

View Full Product Details