Product Details

SNP ID: rs148804829
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.22:26492236 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTTCATGGGCACAGAGCTAGCGGCC[A/G]CGCCAATGCCCCTCTGAGCCATGTT
Phenotype: MIM: 606682 MIM: 602254 MIM: 612747
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: HPS4 PubMed Links

Gene Details

Gene: HPS4
Gene Name: HPS4, biogenesis of lysosomal organelles complex 3 subunit 2

There are no transcripts associated with this gene.

Gene: SRRD
Gene Name: SRR1 domain containing

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001013694.2	1654	Intron			NP_001013716.2
XM_011530178.2	1654	UTR 3			XP_011528480.1
XM_017028799.1	1654	Intron			XP_016884288.1

Gene: TFIP11
Gene Name: tuftelin interacting protein 11

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001008697.1	1654	Missense Mutation	GCG,GTG	A764V	NP_001008697.1
NM_012143.2	1654	Missense Mutation	GCG,GTG	A764V	NP_036275.1
XM_011530079.1	1654	Missense Mutation	GCG,GTG	A764V	XP_011528381.1
XM_017028735.1	1654	Missense Mutation	GCG,GTG	A764V	XP_016884224.1

View Full Product Details