Product Details

SNP ID: rs148811620
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.22:29260823 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACGCCCTCCTGCAGCACCTGCAGCC[A/G]TCGCTCTGAGGGTTCCAGCCACCGG
Phenotype: MIM: 608926 MIM: 133450
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: EMID1 PubMed Links

Gene Details

Gene: EMID1
Gene Name: EMI domain containing 1

There are no transcripts associated with this gene.

Gene: EWSR1
Gene Name: EWS RNA binding protein 1

There are no transcripts associated with this gene.

Gene: RHBDD3
Gene Name: rhomboid domain containing 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_006724224.3	876	Missense Mutation	CGG,TGG	R64W	XP_006724287.1
XM_011530107.2	876	Missense Mutation	CGG,TGG	R192W	XP_011528409.1
XM_017028749.1	876	Missense Mutation	CGG,TGG	R195W	XP_016884238.1
XM_017028750.1	876	Missense Mutation	CGG,TGG	R59W	XP_016884239.1

View Full Product Details