Product Details
- SNP ID
-
rs141917217
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.2:218401665 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GGATGATGGGGAGGCCCTGCCTGCT[C/G]ACAGCGGGGCGCCCCTGCTTGTGGA
- Phenotype
-
MIM: 605323
MIM: 612152
MIM: 600266
- Polymorphism
- C/G, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
CTDSP1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs2227249] are located under a probe and SNP(s) [rs2227251] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- CTDSP1
- Gene Name
- CTD small phosphatase 1
- Gene
- MIR26B
- Gene Name
- microRNA 26b
There are no transcripts associated with this gene.
- Gene
- SLC11A1
- Gene Name
- solute carrier family 11 member 1
There are no transcripts associated with this gene.
View Full Product Details