Product Details

SNP ID: rs142373618
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:27371306 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CACGTGAATGGAGTCCTGCACTGTC[A/G]GGTGCGCTACAGCCAGCTCCTGGGG
Phenotype: MIM: 606687 MIM: 605119 MIM: 605963 MIM: 613598
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: EIF2B4 PubMed Links

Gene Details

Gene: EIF2B4
Gene Name: eukaryotic translation initiation factor 2B subunit delta

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001034116.1	241	Intron			NP_001029288.1
NM_001318965.1	241	Intron			NP_001305894.1
NM_001318966.1	241	Intron			NP_001305895.1
NM_001318967.1	241	Intron			NP_001305896.1
NM_001318968.1	241	Intron			NP_001305897.1
NM_001318969.1	241	Intron			NP_001305898.1
NM_015636.3	241	Intron			NP_056451.3
NM_172195.3	241	Intron			NP_751945.2
XM_006712132.1	241	Intron			XP_006712195.1
XM_011533147.2	241	Intron			XP_011531449.1

Gene: PPM1G
Gene Name: protein phosphatase, Mg2+/Mn2+ dependent 1G

There are no transcripts associated with this gene.

Gene: SNX17
Gene Name: sorting nexin 17

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001267059.1	241	Missense Mutation	CAG,CGG	Q34R	NP_001253988.1
NM_001267060.1	241	Intron			NP_001253989.1
NM_001267061.1	241	Missense Mutation	CAG,CGG	Q14R	NP_001253990.1
NM_014748.3	241	Missense Mutation	CAG,CGG	Q34R	NP_055563.1
XM_011533203.1	241	UTR 5			XP_011531505.1
XM_017005405.1	241	UTR 5			XP_016860894.1

Gene: ZNF513
Gene Name: zinc finger protein 513

There are no transcripts associated with this gene.

View Full Product Details