Product Details
- SNP ID
-
rs142719386
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.2:74472654 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CGCAGACCAAGCCGAGCCAAGGCAG[C/T]TGCCATGGTGACCTCCGCCCCGGAA
- Phenotype
-
MIM: 601336
MIM: 611857
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
CCDC142
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs1047911] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- CCDC142
- Gene Name
- coiled-coil domain containing 142
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_032779.3 |
162 |
Intron |
|
|
NP_116168.3 |
- Gene
- MOGS
- Gene Name
- mannosyl-oligosaccharide glucosidase
There are no transcripts associated with this gene.
- Gene
- MRPL53
- Gene Name
- mitochondrial ribosomal protein L53
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_053050.4 |
162 |
Missense Mutation |
ACT,GCT |
T3A |
NP_444278.1 |
View Full Product Details