Product Details

SNP ID: rs145082926
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:105339681 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TACCATTGCCTCAGAGGGATTTGCC[A/G]AAGAATAGATGGGGGAAAATGATGG
Phenotype: MIM: 606237
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C2orf49 PubMed Links

Gene Details

Gene: C2orf49
Gene Name: chromosome 2 open reading frame 49

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286537.1	529	Silent Mutation	CCA,CCG	P66P	NP_001273466.1
NM_024093.2	529	Silent Mutation	CCA,CCG	P66P	NP_076998.1
XM_017004892.1	529	Silent Mutation	CCA,CCG	P104P	XP_016860381.1

Gene: LOC100506473
Gene Name: uncharacterized LOC100506473

There are no transcripts associated with this gene.

Gene: TGFBRAP1
Gene Name: transforming growth factor beta receptor associated protein 1

There are no transcripts associated with this gene.

View Full Product Details