Product Details

SNP ID: rs150867146
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:219245792 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAGCAGGGCCTGTTTTCTCTACACT[A/G]TAGTGTAGGTTCCAGAGACCTGGGC
Phenotype: MIM: 604719 MIM: 191110
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ANKZF1 PubMed Links

Gene Details

Gene: ANKZF1
Gene Name: ankyrin repeat and zinc finger domain containing 1

There are no transcripts associated with this gene.

Gene: GLB1L
Gene Name: galactosidase beta 1 like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286423.1	283	Intron			NP_001273352.1
NM_001286427.1	283	Intron			NP_001273356.1
NM_024506.4	283	Intron			NP_078782.3
XM_011511813.2	283	Intron			XP_011510115.1
XM_017004895.1	283	Intron			XP_016860384.1

Gene: STK16
Gene Name: serine/threonine kinase 16

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_011512067.2	283	Intron			XP_011510369.1
XM_017005160.1	283	UTR 5			XP_016860649.1

Gene: TUBA4A
Gene Name: tubulin alpha 4a

There are no transcripts associated with this gene.

Gene: TUBA4B
Gene Name: tubulin alpha 4b

There are no transcripts associated with this gene.

View Full Product Details