Product Details

SNP ID: rs121918136
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:49022146 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GACTTCGCCGCGCGTTGGTCAGCCA[C/T]GGCCACCGCTCTCGCGCTACGTAGC
Phenotype: MIM: 146691 MIM: 615150 MIM: 612911 MIM: 606031
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: DALRD3 PubMed Links

Gene Details

Gene: DALRD3
Gene Name: DALR anticodon binding domain containing 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001009996.2	506	Intron			NP_001009996.1
NM_001276405.1	506	Intron			NP_001263334.1
NM_018114.5	506	Intron			NP_060584.3
XM_005265269.3	506	Intron			XP_005265326.1
XM_006713219.2	506	Intron			XP_006713282.1
XM_011533891.1	506	Intron			XP_011532193.1
XM_011533892.1	506	Intron			XP_011532194.1
XM_011533893.1	506	Intron			XP_011532195.1
XM_017006723.1	506	Intron			XP_016862212.1

Gene: IMPDH2
Gene Name: inosine monophosphate dehydrogenase 2

There are no transcripts associated with this gene.

Gene: MIR191
Gene Name: microRNA 191

There are no transcripts associated with this gene.

Gene: MIR425
Gene Name: microRNA 425

There are no transcripts associated with this gene.

Gene: NDUFAF3
Gene Name: NADH:ubiquinone oxidoreductase complex assembly factor 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_199069.1	506	Missense Mutation	ACG,ATG	T1M	NP_951032.1
NM_199070.1	506	Intron			NP_951033.1
NM_199073.1	506	Intron			NP_951047.1
NM_199074.1	506	Intron			NP_951056.1

Gene: QRICH1
Gene Name: glutamine rich 1

There are no transcripts associated with this gene.

Gene: WDR6
Gene Name: WD repeat domain 6

There are no transcripts associated with this gene.

View Full Product Details