Product Details

SNP ID
rs140818964
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.3:197047561 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
AGGAGGAAGTTAAAGGACAAGGCGA[A/G]TAAAATAAGAATATTGGGGAGTTGC
Phenotype
MIM: 601014
Polymorphism
A/G, Transition Substitution
Allele Nomenclature
Literature Links
DLG1 PubMed Links
Additional Information
For this assay, SNP(s) [rs34189947] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
DLG1
Gene Name
discs large MAGUK scaffold protein 1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001098424.1 Intron NP_001091894.1
NM_001204386.1 Intron NP_001191315.1
NM_001204387.1 Intron NP_001191316.1
NM_001204388.1 Intron NP_001191317.1
NM_001290983.1 Intron NP_001277912.1
NM_004087.2 Intron NP_004078.2
XM_005269289.3 Intron XP_005269346.1
XM_011512502.2 Intron XP_011510804.1
XM_011512503.1 Intron XP_011510805.1
XM_011512505.1 Intron XP_011510807.1
XM_011512506.1 Intron XP_011510808.1
XM_011512509.1 Intron XP_011510811.1
XM_017005800.1 Intron XP_016861289.1
XM_017005801.1 Intron XP_016861290.1
XM_017005802.1 Intron XP_016861291.1
XM_017005803.1 Intron XP_016861292.1
XM_017005804.1 Intron XP_016861293.1
XM_017005805.1 Intron XP_016861294.1
XM_017005806.1 Intron XP_016861295.1
XM_017005807.1 Intron XP_016861296.1
XM_017005808.1 Intron XP_016861297.1
XM_017005809.1 Intron XP_016861298.1
XM_017005810.1 Intron XP_016861299.1
XM_017005811.1 Intron XP_016861300.1
XM_017005812.1 Intron XP_016861301.1
XM_017005813.1 Intron XP_016861302.1
XM_017005814.1 Intron XP_016861303.1
XM_017005815.1 Intron XP_016861304.1
XM_017005816.1 Intron XP_016861305.1
XM_017005817.1 Intron XP_016861306.1
XM_017005818.1 Intron XP_016861307.1
XM_017005819.1 Intron XP_016861308.1
XM_017005820.1 Intron XP_016861309.1
XM_017005821.1 Intron XP_016861310.1
XM_017005822.1 Intron XP_016861311.1
XM_017005823.1 Intron XP_016861312.1
XM_017005824.1 Intron XP_016861313.1

View Full Product Details