Product Details

SNP ID: rs144698224
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:49419094 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCTGCCAGCCCTGCCAGCTTCACCT[C/T]TGGGTTTTTCAGAATAGCTGTTGCC
Phenotype: MIM: 238310 MIM: 611516 MIM: 165390 MIM: 600690
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: AMT PubMed Links

Gene Details

Gene: AMT
Gene Name: aminomethyltransferase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000481.3	850	Missense Mutation	AAG,GAG	K252E	NP_000472.2
NM_001164710.1	850	Missense Mutation	AAG,GAG	K208E	NP_001158182.1
NM_001164711.1	850	Missense Mutation	AAG,GAG	K196E	NP_001158183.1
NM_001164712.1	850	Missense Mutation	AAG,GAG	K252E	NP_001158184.1

Gene: NICN1
Gene Name: nicolin 1

There are no transcripts associated with this gene.

Gene: RHOA
Gene Name: ras homolog family member A

There are no transcripts associated with this gene.

Gene: TCTA
Gene Name: T-cell leukemia translocation altered

There are no transcripts associated with this gene.

View Full Product Details