Product Details

SNP ID: rs145923964
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:196323951 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACGTGCCAGACAACAGCTGCAGAGG[C/G]CTCCAGGCAGACGGAGTTCCAGAGC
Phenotype
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: TCTEX1D2 PubMed Links

Gene Details

Gene: TCTEX1D2
Gene Name: Tctex1 domain containing 2

There are no transcripts associated with this gene.

Gene: TM4SF19
Gene Name: transmembrane 4 L six family member 19

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204897.1	654	Silent Mutation	AGC,AGG	S164R	NP_001191826.1
NM_001204898.1	654	Missense Mutation	CCC,GCC	P140A	NP_001191827.1
NM_138461.3	654	Missense Mutation	CCC,GCC	P166A	NP_612470.2

Gene: TM4SF19-AS1
Gene Name: TM4SF19 antisense RNA 1

There are no transcripts associated with this gene.

Gene: TM4SF19-TCTEX1D2
Gene Name: TM4SF19-TCTEX1D2 readthrough (NMD candidate)

There are no transcripts associated with this gene.

View Full Product Details