Product Details

SNP ID: rs146326621
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:112122464 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATAGATATAATTTGAGGAACACTAA[A/G]GAAAAGATAAGAGAAAGTAAATAAT
Phenotype: MIM: 611956 MIM: 607792
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C3orf52 PubMed Links

Gene Details

Gene: C3orf52
Gene Name: chromosome 3 open reading frame 52

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001171747.1	1648	Intron			NP_001165218.1
NM_024616.2	1648	Intron			NP_078892.2
XM_011513133.2	1648	Intron			XP_011511435.1
XM_017007181.1	1648	Intron			XP_016862670.1

Gene: GCSAM
Gene Name: germinal center associated signaling and motility

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001190259.1	1648	UTR 3			NP_001177188.1
NM_001190260.1	1648	UTR 3			NP_001177189.1
NM_152785.4	1648	UTR 3			NP_689998.1
XM_005247272.2	1648	UTR 3			XP_005247329.1
XM_011512627.2	1648	UTR 3			XP_011510929.1
XM_011512628.2	1648	UTR 3			XP_011510930.1
XM_011512629.1	1648	UTR 3			XP_011510931.1
XM_011512630.1	1648	UTR 3			XP_011510932.1

Gene: MIR567
Gene Name: microRNA 567

There are no transcripts associated with this gene.

View Full Product Details