Product Details

SNP ID: rs146372949
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:50358396 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GATCTCAGGGAAGAAAGTGGCGAAA[C/G]CAAAGTGGTCAGCCATGTCCCCTCG
Phenotype: MIM: 607082 MIM: 607068 MIM: 607072 MIM: 607069
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: CACNA2D2 PubMed Links

Gene Details

Gene: CACNA2D2
Gene Name: calcium voltage-gated channel auxiliary subunit alpha2delta 2

There are no transcripts associated with this gene.

Gene: CYB561D2
Gene Name: cytochrome b561 family member D2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001291284.1	1113	Intron			NP_001278213.1
NM_007022.4	1113	Intron			NP_008953.1

Gene: NPRL2
Gene Name: NPR2-like, GATOR1 complex subunit

There are no transcripts associated with this gene.

Gene: TMEM115
Gene Name: transmembrane protein 115

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_007024.4	1113	Missense Mutation	GCT,GGT	A223G	NP_008955.1

View Full Product Details