Product Details

SNP ID: rs146792880
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:49412496 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CACGGTGCTGGGCGCGCTGGGCAGC[A/G]AGTTCTTGCGGGAGTGGGAGGCGCA
Phenotype: MIM: 238310 MIM: 611516 MIM: 165390 MIM: 600690
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: AMT PubMed Links

Gene Details

Gene: AMT
Gene Name: aminomethyltransferase

There are no transcripts associated with this gene.

Gene: NICN1
Gene Name: nicolin 1

There are no transcripts associated with this gene.

Gene: RHOA
Gene Name: ras homolog family member A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001313941.1	291	Intron			NP_001300870.1
NM_001313943.1	291	Intron			NP_001300872.1
NM_001313944.1	291	Intron			NP_001300873.1
NM_001313945.1	291	Intron			NP_001300874.1
NM_001313946.1	291	Intron			NP_001300875.1
NM_001313947.1	291	Intron			NP_001300876.1
NM_001664.3	291	Intron			NP_001655.1

Gene: TCTA
Gene Name: T-cell leukemia translocation altered

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_022171.2	291	Missense Mutation	AAG,GAG	K24E	NP_071503.1

View Full Product Details