Product Details

SNP ID

rs138216547

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.4:849994 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CCACGGGCGTCCAGCGGCTCTCCCC[G/T]TCCCACAGCACTGTGTGCAGCGTGG

Phenotype

MIM: 602052

Polymorphism

G/T, Transversion Substitution

Allele Nomenclature

Literature Links

GAK PubMed Links

Additional Information

For this assay, SNP(s) [rs2306242] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

GAK

Gene Name

cyclin G associated kinase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318134.1	4007	Silent Mutation			NP_001305063.1
NM_005255.3	4007	Silent Mutation			NP_005246.2
XM_005272268.2	4007	Silent Mutation			XP_005272325.1
XM_005272270.2	4007	Silent Mutation			XP_005272327.1
XM_011513425.2	4007	Silent Mutation			XP_011511727.1
XM_011513426.2	4007	Silent Mutation			XP_011511728.1
XM_011513427.2	4007	Missense Mutation			XP_011511729.1
XM_011513428.2	4007	Silent Mutation			XP_011511730.1
XM_011513429.2	4007	Silent Mutation			XP_011511731.1
XM_011513430.1	4007	Silent Mutation			XP_011511732.1
XM_011513431.2	4007	Silent Mutation			XP_011511733.1
XM_011513432.2	4007	Silent Mutation			XP_011511734.1
XM_011513434.2	4007	Silent Mutation			XP_011511736.1
XM_017007991.1	4007	Silent Mutation			XP_016863480.1
XM_017007992.1	4007	Silent Mutation			XP_016863481.1
XM_017007993.1	4007	Silent Mutation			XP_016863482.1
XM_017007994.1	4007	Intron			XP_016863483.1
XM_017007995.1	4007	Silent Mutation			XP_016863484.1

View Full Product Details