Product Details

SNP ID: rs143426149
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.4:2931557 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCGCTTTGGAGGGAGCCCCCTACCC[A/G]CTTCACGGCAGCAACTTCCCCGCCA
Phenotype: MIM: 102680 MIM: 610977 MIM: 611526
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ADD1 PubMed Links

Gene Details

Gene: ADD1
Gene Name: adducin 1

There are no transcripts associated with this gene.

Gene: MFSD10
Gene Name: major facilitator superfamily domain containing 10

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001120.4	1128	Missense Mutation	CGG,TGG	R341W	NP_001111.3
NM_001146069.1	1128	Missense Mutation	CGG,TGG	R341W	NP_001139541.1
XM_005247927.3	1128	Missense Mutation	CGG,TGG	R341W	XP_005247984.1

Gene: NOP14
Gene Name: NOP14 nucleolar protein

There are no transcripts associated with this gene.

Gene: NOP14-AS1
Gene Name: NOP14 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details