Product Details

SNP ID: rs147639214
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.4:74312288 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTGCTTGTGCATTCCACCATGAGCT[A/G]GAGAAAGCCATCTGCAGGTAAATGC
Phenotype: MIM: 614047
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: EPGN PubMed Links

Gene Details

Gene: EPGN
Gene Name: epithelial mitogen

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001270989.1	301	Silent Mutation	CTA,CTG	L79L	NP_001257918.1
NM_001270990.1	301	Silent Mutation	CTA,CTG	L79L	NP_001257919.1
NM_001270991.1	301	Silent Mutation	CTA,CTG	L70L	NP_001257920.1
NM_001270992.1	301	Silent Mutation	CTA,CTG	L79L	NP_001257921.1
NM_001270993.1	301	Silent Mutation	CTA,CTG	L70L	NP_001257922.1
XM_005265666.4	301	Silent Mutation	CTA,CTG	L70L	XP_005265723.1
XM_011531817.2	301	Silent Mutation	CTA,CTG	L70L	XP_011530119.1

Gene: LOC105377276
Gene Name: uncharacterized LOC105377276

There are no transcripts associated with this gene.

Gene: MTHFD2L
Gene Name: methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like

There are no transcripts associated with this gene.

View Full Product Details