Product Details

SNP ID: rs141209810
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:14706846 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTGCTCAAAAACATGCTTTCCTACG[A/G]TTTGAGTGCTTTATATGAGAGCCAT
Phenotype: MIM: 605145 MIM: 615712
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ANKH PubMed Links

Gene Details

Gene: ANKH
Gene Name: ANKH inorganic pyrophosphate transport regulator

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_054027.4	6161	UTR 3			NP_473368.1
XM_011514067.1	6161	Intron			XP_011512369.1
XM_017009644.1	6161	UTR 3			XP_016865133.1

Gene: LOC100130744
Gene Name: uncharacterized LOC100130744

There are no transcripts associated with this gene.

Gene: OTULIN
Gene Name: OTU deubiquitinase with linear linkage specificity

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_138348.4	6161	Intron			NP_612357.4
XM_011514151.2	6161	Intron			XP_011512453.1
XM_011514152.2	6161	Intron			XP_011512454.1
XM_011514154.2	6161	Intron			XP_011512456.1
XM_017010015.1	6161	Intron			XP_016865504.1

View Full Product Details