Product Details

SNP ID: rs149268243
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:176397646 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTTCTTCTCTACTTGTTCACTCTGG[C/T]GCTGGTTCCACTCCTCCAGGTCCTT
Phenotype: MIM: 118970 MIM: 612861
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ARL10 PubMed Links

Gene Details

Gene: ARL10
Gene Name: ADP ribosylation factor like GTPase 10

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001317948.1	630	Intron			NP_001304877.1
NM_173664.5	630	Intron			NP_775935.1
XM_011534529.2	630	Intron			XP_011532831.1
XM_011534530.2	630	Intron			XP_011532832.1
XM_011534531.2	630	Intron			XP_011532833.1
XM_017009372.1	630	Intron			XP_016864861.1

Gene: CLTB
Gene Name: clathrin light chain B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001834.3	630	Missense Mutation	CAC,CGC	H142R	NP_001825.1
NM_007097.3	630	Missense Mutation	CAC,CGC	H142R	NP_009028.1
XM_017009026.1	630	Missense Mutation	CAC,CGC	H75R	XP_016864515.1
XM_017009027.1	630	Intron			XP_016864516.1

Gene: HIGD2A
Gene Name: HIG1 hypoxia inducible domain family member 2A

There are no transcripts associated with this gene.

Gene: NOP16
Gene Name: NOP16 nucleolar protein

There are no transcripts associated with this gene.

View Full Product Details