Product Details
- SNP ID
-
rs112802855
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.6:32813776 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TCCCACCAGAAGGAAGATTAGCCCA[A/G]GTAGGAAGGCTGCAATGCCACTCAG
- Phenotype
-
MIM: 600629
MIM: 170261
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
HLA-DOB
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs2070121] are located under a probe and SNP(s) [rs2621330] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- HLA-DOB
- Gene Name
- major histocompatibility complex, class II, DO beta
There are no transcripts associated with this gene.
- Gene
- TAP2
- Gene Name
- transporter 2, ATP binding cassette subfamily B member
There are no transcripts associated with this gene.
View Full Product Details