Product Details

SNP ID

rs143653188

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.6:26385029 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TTGTTGAACAGCCCAGTTTACTGTC[A/G]TGGGGCCAGCTAATCCCATCCTGGC

Phenotype

MIM: 613591 MIM: 613594

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

BTN2A2 PubMed Links

Additional Information

For this assay, SNP(s) [rs4490658] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

BTN2A2

Gene Name

butyrophilin subfamily 2 member A2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001197237.1	211	Missense Mutation	ATG,GTG	M37V	NP_001184166.1
NM_001197238.1	211	Missense Mutation	ATG,GTG	M37V	NP_001184167.1
NM_001197239.1	211	Intron			NP_001184168.1
NM_001197240.1	211	Missense Mutation	ATG,GTG	M37V	NP_001184169.1
NM_006995.4	211	Missense Mutation	ATG,GTG	M37V	NP_008926.2
NM_181531.2	211	Intron			NP_853509.1
XM_005248797.3	211	Missense Mutation	ATG,GTG	M37V	XP_005248854.1
XM_005248798.4	211	Intron			XP_005248855.1
XM_006714953.3	211	Missense Mutation	ATG,GTG	M37V	XP_006715016.1
XM_006714955.3	211	Missense Mutation	ATG,GTG	M37V	XP_006715018.1
XM_011514228.2	211	Missense Mutation	ATG,GTG	M37V	XP_011512530.1
XM_011514229.2	211	Missense Mutation	ATG,GTG	M37V	XP_011512531.1
XM_011514231.2	211	Intron			XP_011512533.1
XM_017010166.1	211	Missense Mutation	ATG,GTG	M37V	XP_016865655.1
XM_017010167.1	211	Intron			XP_016865656.1
XM_017010168.1	211	Missense Mutation	ATG,GTG	M37V	XP_016865657.1
XM_017010169.1	211	Missense Mutation	ATG,GTG	M37V	XP_016865658.1

Gene

BTN3A2

Gene Name

butyrophilin subfamily 3 member A2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001197246.2	211	Intron			NP_001184175.1
NM_001197247.2	211	Intron			NP_001184176.1
NM_001197248.2	211	Intron			NP_001184177.1
NM_001197249.2	211	Intron			NP_001184178.1
NM_007047.4	211	Intron			NP_008978.2
XM_005248827.3	211	Intron			XP_005248884.1
XM_005248831.3	211	Intron			XP_005248888.1
XM_005248832.3	211	Intron			XP_005248889.1
XM_006714979.3	211	Intron			XP_006715042.1
XM_006714980.3	211	Intron			XP_006715043.1
XM_006714981.3	211	Intron			XP_006715044.1
XM_006714982.3	211	Intron			XP_006715045.1
XM_011514267.2	211	Intron			XP_011512569.1
XM_011514268.2	211	Intron			XP_011512570.1
XM_011514269.2	211	Intron			XP_011512571.1
XM_011514270.2	211	Intron			XP_011512572.1
XM_011514271.2	211	Intron			XP_011512573.1
XM_017010211.1	211	Intron			XP_016865700.1
XM_017010212.1	211	Intron			XP_016865701.1
XM_017010213.1	211	Intron			XP_016865702.1
XM_017010214.1	211	Intron			XP_016865703.1
XM_017010215.1	211	Intron			XP_016865704.1
XM_017010216.1	211	Intron			XP_016865705.1
XM_017010217.1	211	Intron			XP_016865706.1

View Full Product Details