Product Details

SNP ID: rs143674381
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:109445281 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCAGCCTCAATCTCATTTAGTCGCC[A/G]TTGGATGGTCTGAGGGGTACAAGAC
Phenotype: MIM: 607129 MIM: 603498
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MICAL1 PubMed Links

Gene Details

Gene: MICAL1
Gene Name: microtubule associated monooxygenase, calponin and LIM domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001159291.1	3145	Missense Mutation	CGG,TGG	R847W	NP_001152763.1
NM_001286613.1	3145	Missense Mutation	CGG,TGG	R952W	NP_001273542.1
NM_022765.3	3145	Missense Mutation	CGG,TGG	R933W	NP_073602.3

Gene: PPIL6
Gene Name: peptidylprolyl isomerase like 6

There are no transcripts associated with this gene.

Gene: SMPD2
Gene Name: sphingomyelin phosphodiesterase 2

There are no transcripts associated with this gene.

View Full Product Details