Product Details

SNP ID: rs139262165
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:32489273 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTGACAAAGTCATCAAATCCTAGAA[A/G]AGTACCAACAATTTCCTTATCACTC
Phenotype: MIM: 612927 MIM: 607285
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: AVL9 PubMed Links

Gene Details

Gene: AVL9
Gene Name: AVL9 cell migration associated

There are no transcripts associated with this gene.

Gene: LSM5
Gene Name: LSM5 homolog, U6 small nuclear RNA and mRNA degradation associated

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001130710.1	164	Missense Mutation	CTT,TTT	L11F	NP_001124182.1
NM_001139499.1	164	Missense Mutation	CTT,TTT	L11F	NP_001132971.1
NM_012322.2	164	Missense Mutation	CTT,TTT	L40F	NP_036454.1

View Full Product Details