Product Details

SNP ID: rs142061761
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:100430574 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGACTCTGTGTTACCCTCCAACTTC[C/T]TCCTGGGGGGCAATATCTTTGATCC
Phenotype: MIM: 611478
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MEPCE PubMed Links

Gene Details

Gene: MEPCE
Gene Name: methylphosphate capping enzyme

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001194990.1	944	Intron			NP_001181919.1
NM_001194991.1	944	Intron			NP_001181920.1
NM_001194992.1	944	Intron			NP_001181921.1
NM_019606.5	944	Missense Mutation	CTC,TTC	L186F	NP_062552.2
XM_011516410.2	944	Intron			XP_011514712.1

Gene: PPP1R35
Gene Name: protein phosphatase 1 regulatory subunit 35

There are no transcripts associated with this gene.

Gene: ZCWPW1
Gene Name: zinc finger CW-type and PWWP domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001258008.1	944	Intron			NP_001244937.1
NM_017984.4	944	Intron			NP_060454.3

View Full Product Details