Product Details

SNP ID: rs143377555
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:151241597 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGGCCTGGACAATGGCTGAGCGGCT[C/G]TGTGTGTGCAGCCCCAGCAGCCGGG
Phenotype: MIM: 608037 MIM: 615245 MIM: 601737
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: CHPF2 PubMed Links

Gene Details

Gene: CHPF2
Gene Name: chondroitin polymerizing factor 2

There are no transcripts associated with this gene.

Gene: MIR671
Gene Name: microRNA 671

There are no transcripts associated with this gene.

Gene: SMARCD3
Gene Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001003801.1	924	Missense Mutation	CAC,CAG	H278Q	NP_001003801.1
NM_001003802.1	924	Missense Mutation	CAC,CAG	H265Q	NP_001003802.1
NM_003078.3	924	Missense Mutation	CAC,CAG	H265Q	NP_003069.2
XM_011516521.2	924	Missense Mutation	CAC,CAG	H176Q	XP_011514823.1
XM_017012556.1	924	Missense Mutation	CAC,CAG	H113Q	XP_016868045.1

View Full Product Details