Product Details
- SNP ID
-
rs145582808
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.7:64991613 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TCCTTCCAATCTCCTATAGTTATGC[C/G]TCTTTTGCTTTTCCTTTTAGTTTCA
- Phenotype
-
MIM: 131170
MIM: 194624
- Polymorphism
- C/G, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
ERV3-1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs4618579] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ERV3-1
- Gene Name
- endogenous retrovirus group 3 member 1
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_001007253.3 |
2008 |
Missense Mutation |
CGC,GGC |
R472G |
NP_001007254.2 |
- Gene
- ZNF117
- Gene Name
- zinc finger protein 117
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_015852.3 |
2008 |
Intron |
|
|
NP_056936.2 |
View Full Product Details